Home | Register | Login | Inquiries | Alerts | Sitemap |  


Advanced Search
JKM > Volume 38(3); 2017 > Article
Ahn and Lim: Effect of Sochungryong-tang Extract on Osteoclast Differentiation and Bone-pit Formation

Abstract

Objectives

This study was performed to evaluate effects of Sochungryong-tang Extract(SRE) on osteoclast differentiation and bone resorptionin order to find out the possibility for clinical use in preventing and treating osteoporosis.

Methods

To evaluate the effect of SRE on osteoclast differentiation, we induced RAW 264. 7 cells to be differentiated to osteoclasts by RANKL (receptor activator of nuclear factor-κB ligand). We measured effect on TRAP (Tartrate-resistant acid phosphatase), NFATc, cathepsin K, MMP-9, inflammation related factors, histogenesis factors and bone resorption.

Results

SRE decreased osteoclast differentiation, and also decreased expression of bone resorbing factors such as MMP-9, cathepsin K, TRAP, NFATc1, MITF, c-Fos, osteoclast stimulatory transmembrane protein, calcitonin receptor in RANKL-induced osteoclast. SRE also decreased Cyclooxygenase-2, indusible nitric oxide synthase, TNF-α, which are thought to be related with the inflammatory bone destruction.

Conclusion

SRE inhibits osteoclast differentiation and bone resorption. The results indicate that the BHT extract can potentially be applied for preventing and treating osteoporosis.

Fig. 1
Effect of SRE on cell viability.
A : RANKL(100 ng/m) only
B : RANKL(100 ng/m) + 18.7 μg/m of SRE
C : RANKL(100 ng/m) + 37.5 μg/m of SRE
D : RANKL(100 ng/m) + 75 μg/m of SRE
E : RANKL(100 ng/m) + 150 μg/m of SRE
F : RANKL(100 ng/m) + 300 μg/m of SRE
Each bar represents Mean±SD of 5 tests.
** : p<0.01 vs RANKL only
jkm-38-3-59f1.gif
Fig. 2
Effects of SRE on the formation of TRAP(+) MNCs in RANKL stimulated osteoclast.
0 : RANKL(100 ng/m) only
30 : RANKL(100 ng/m) + 30 μg/m of SRE
60 : RANKL(100 ng/m) + 60 μg/m of SRE
120 : RANKL(100 ng/m) + 120 μg/m of SRE
Each bar represents Mean±SD of 5 tests.
**: p<0.01 vs RANKL only
jkm-38-3-59f2.gif
Fig. 3
Effects of SRE on (A)TRAP, (B) MMP-9 and (C)cathepsin K gene expression in RANKL-stimulated osteoclast.
NC : Vehicle
0 : RANKL(100 ng/m) only
30 : RANKL(100 ng/m) + 30 μg/m of SRE
60 : RANKL(100 ng/m) + 60 μg/m of SRE
120 : RANKL(100 ng/m) + 120 μg/m of SRE
Each bar represents Mean±SD of 5 tests.
* : p<0.05 vs NC
# : p<0.05 vs RANKL only
jkm-38-3-59f3.gif
Fig. 4
Effects of SRE on (A)NFATc1, (B)c-Fos and (C)MITF gene expression in RANKL-stimulated osteoclast.
NC : Vehicle
0 : RANKL(100 ng/m) only
30 : RANKL(100 ng/m) + 30 μg/m of SRE
60 : RANKL(100 ng/m) + 60 μg/m of SRE
120 : RANKL(100 ng/m) + 120 μg/m of SRE
Each bar represents Mean±SD of 5 tests.
* : p<0.05 vs NC
# : p<0.05 vs RANKL only
jkm-38-3-59f4.gif
Fig. 5
Effects of SRE on iNOS, COX-2, TNF-a, IL-6 gene expression in RANKL-stimulated osteoclast.
0 : RANKL(100 ng/m) only
30 : RANKL(100 ng/m) + 30 μg/m of SRE
60 : RANKL(100 ng/m) + 60 μg/m of SRE
120 : RANKL(100 ng/m) + 120 μg/m of SRE
Each bar represents Mean±SD of 5 tests.
** : p<0.01 vs RANKL only
jkm-38-3-59f5.gif
Fig. 6
Effects of SRE on (A)OC-STAMP and (B)CTR gene expression in RANKL-stimulated osteoclast.
NC : Vehicle
0 : RANKL(100 ng/m) only
30 : RANKL(100 ng/m) + 30 μg/m of SRE
60 : RANKL(100 ng/m) + 60 μg/m of SRE
120 : RANKL(100 ng/m) + 120 μg/m of SRE
Each bar represents Mean±SD of 5 tests.
** : p<0.01 vs NC
## : p<0.01 vs RANKL only
jkm-38-3-59f6.gif
Fig. 7
Effect of SRE on bone pit formation by RANKL-induced Osteoclast.
NC : Vehicle
0 : RANKL(100 ng/m) only
60 : RANKL(100 ng/m) + 60 μg/m of SRE
120 : RANKL(100 ng/m) + 120 μg/m of SRE
jkm-38-3-59f7.gif
Table 1
Composition of Sochungryong-tang
Herbal name Pharmacognostic Name Dose amount(g)
麻黃 Ephedrae Herba 6
桂枝 Cinnamomi Ramulus 6
白芍藥 Paeoniae Radix 6
半夏 Pinelliae Tuber 6
乾薑 Zingiberis Rhizoma 4
五味子 Schizandra Fructus 2
細辛 Asari Herba 2
甘草 Glycyrrhizae Radix et Rhizoma 2
Table 2
Primers
Target gene Forward (5′-3′) Reverse (5′-3′)
TRAP ACACAGTGATGCTGTGTGGCAACTC CCAGAGGCTTCCACATATATGATGG
Cathepsin K AGGCGGCTATATGACCACTG CCGAGCCAAGAGAGCATATC
MMP-9 CGTCGTGATCCCCACTTACT AGAGTACTGCTTGCCCAGGA
NFATc1 GGGTCAGTGTGACCGAAGAT GGAAGTCAGAAGTGGGTGGA
iNOS CCTTGTTCAGCTACGCCTTC AAGGCCAAACACAGCATACC
MITF GGAACAGCAACGAGCTAAGG TGATGATCCGATTCACCAGA
b-actin TCACCCACACTCTGCCCAT TCCTTAATGTCACGCACCATTT

참고문헌

1. Guideline Development Committee, Korean Society of Bone Metabolism. Osteoporosis Diagnosis and Treatment. Seoul: Mincom;2015. p. 1–10.


2. Ministry of Health and Welfare. Health Behavior and Chronic Disease Statistics. 2012.


3. Kim SW. Management of osteoporosis: Who to treat, what to use, and for how long? Korean J Med. 2013; 85:4. 364–73.
crossref

4. Yoon SJ, Kim KY, Kim GY, Nam KW, Sim KC, Kim EJ, et al. Effects of Eucommia Ulmoides Oliver and Treadmill Exercise on the Osteoporosis of Rats Caused by Glucocorticoid Induction. Korean J Oriental Physiology & Pathology. 2008; 22:4. 884–90.


5. Jeong YH, Kim RY, Lee TK, Kim DI. Hominis Placenta suppress Calcium release, cyclooxygenase expression and PGE2 synthesis. The Journal of Oriental Obstetrics & Gynecology. 2005; 18:1. 55–63.


6. Kim EJ, Kim GY, Kim YE, Jang MK, Kim YI, Kim HW, et al. Effect of Biochemical Makers of Bone Metabolism by Administration of Achyrantes Radix Concentration in Ovariectomized Rats. Korean J Oriental Physiology & Pathology. 2007; 21:4. 967–72.


7. Hwang JS, Seo BI, Park JH, Roh SS, Kim MR, Kim SM, et al. Effect of Cervi Cornu On treatment of Osteoporosis in Ovariectomized Rats. Kor J Herbology. 2010; 25:2. 1–10.


8. Koo YM, Kim SH, Kim EY, Lee HS, Choi H, Sohn YJ, et al. Effects of Lycii Fructus on the Ovariectomized Osteoporosis of Rats. J Korean Oriental Med. 2008; 29:3. 144–54.


9. Seo GT, Seo BI, Park JH, Lee ES, Choi DJ, Choi HS, et al. Effect of Polygoni Multiflori Radix and Polygoni Multiflori Radix Preparat On Prevention of Osteoporosis In Ovariectomized Rats. Kor J Herbology. 2005; 20:2. 137–48.


10. Kwak HB, Choi MK. Inhibitory Mechanism of Curcumin in Osteoclast Differentiation. Korean J Oriental Physiology & Pathology. 2008; 22:4. 796–801.


11. Han DH, An JJ, Jo HK, Yoo HR, Kim YS, Seol IC. Experimental Studys of GMJST on Bone Growth Factors;Proliferation of Osteoblast and Supression of Osteoclast. Korean J Oriental Physiology & Pathology. 2008; 22:4. 802–9.


12. Han DH, Kang HJ, An JJ, Jo HK, Yoo HR, Seol IC, Kim YS. Effect of Gucheokbogol-tang in Proliferation and Calcification of Osteoblast. Korean J Oriental Physiology & Pathology. 2008; 22:1. 142–7.


13. Shim KS, Lee JH, Lee JH, Ma JY. Effect of Ssangwha-tang Fermented by Lactobacillus fermentum on Osteoclast Differentiation and Osteoporosis of Ovariectomized Rats. KOREAN JOURNAL OF ORIENTAL MEDICINE. 2010; 16:1. 149–55.


14. Park SM, Yoo DY. Effects of Samkieumgamibang Extract on Osteoclast Differentiation and Osteoblast Function. The Journal of Oriental Obstetrics & Gynecology. 2012; 25:2. 23–42.


15. Park CS, Sohn YJ. A Study on the Effects of Gamisoyosan on Ovariectomized Osteoporosis in Rats. The Journal of Oriental Obstetrics & Gynecology. 2008; 21:1. 1–15.


16. Seo MS, Kim HC, Choo WJ, Jeong SY, Kim SJ, Choi JU, et al. The Review on the Study of Osteoporosis in Korean Medicine Journals. The Journal of Korea CHUNA Manual Medicine for Spine & Nerves. 2013; 8:2. 67–78.


17. Lee SY, Seo BI, Park JH, Noh SS, Kim DJ. Effect of Ligustri Lucidi Fructus Extract and Vici Herba Extract on Treatment of Osteoporosis in Ovariectomized Rat. KOREAN JOURNAL OF ORIENTAL MEDICINE. 2011; 17:1. 153–65.
crossref

18. Song KC, Hwang GS. Effects of Houyttnia cordata on bone marrow stromal cell and osteoporetic rat. Kor JOriental Preventive Medical Society. 2009; 13:2. 103–13.


19. Ju IH, Lee EK, Hwang GS, Chong MS. Effects of Saengmaek-san(SM) on osteoclastogenesis and gene expression. Kor J Oriental Preventive Medical Society. 2015; 19:2. 135–44.


20. Amagaya S, Iizuka A, Makino B, Kubo M, Komatsu Y, Cheng FC, et al. General pharmacological properties of Sho-seiryu-to (TJ-19) extracts. Phytomedicine. 2001; 8:5. 338–47.
crossref

21. Jung JW, Kang HR, Kim JY, Lee SH, Kim SS, Cho SH. Are asthmatic patients prone to bone loss? Ann Allergy Asthma Immunol. 2014; 112:5. 426–31.
crossref

22. Lee EJ, Choi BK, Hwang ES, Chang EJ. Interleukin-32 Gamma as a new face in inflammatory bone diseases. J Rheum Dis. 2017; 24:1. 14–20.
crossref

23. Cosman F, de Beur SJ, LeBoff MS, et al. Clinician’s guide to prevention and treatment of osteoporosis. Osteoporos Int. 2014; 25:2359–81.
crossref

24. The Korean Acamdemy of Clinical Geriatrics. Principles of Geriatric Medicine. Seoul: HanKukmb;2011. p. 399


25. Kim JH, Shin HK. Analysis of Biological Experiment on Socheongryong-tang(Xiaoqinglong-tang). J Korean Oriental Med. 2012; 33:3. 54–73.


26. Woo YJ, Lee MY, Lim HS, Shin IS, Kim YJ, Jin SE, et al. Experimental Studies on the inflammation-related diseases pharmacological effect of water and 70% ethanol extracts from Socheongnyong-tang. Fomula science. 2012; 20:2. 13–28.


27. Yavropoulou MP, Yovos JG. Osteoclstogenesis Current knowledge and future perspectives. J Musculoskelet Neuronal Interact. 2008; 8:3. 204–16.


28. Kim HK, Kim JS, Yoon SH, Ryu BH. Radioprotective Effect of Saengmaek-san on Mice Jejunal Crypt Cell Survival and Apoptosis. Kor J Orient Int Med. 2006; 27:2. 316–26.
crossref

29. Kim JY, Hwang GS. The effects of Cuscuta japonica Chois on gene expression in RANKL -induced RAW 264.7 cell. Kor J Oriental Preventive Medical Society. 2010; 14:2. 77–89.


30. Pang M, Martinez AF, Fernandez 1, Ba1kan W, Troen BR. AP-1 stimulates the cathepsin K promoter in RAW 264.7 cells. Gene. 2007; 403:1–2. 151–8.
crossref

31. Yoo M, Youn Y, Lee N, Choi S. Cellu1ar proteins related to osteoclastogenesis in RAW 264.7 cells. Cancer Prevention Research. 2007; 12:310–8.


32. Kim SJ, Lee JJ, Kim JH, Jo SH, Park MC, Jo EH. Inhibitory Effects of Ssangbohwan on Osteoclast Differentiation and Bone Resorption. The Acupuncture. 2015; 32:3. 69–81.
crossref

33. Choi KH, Yoo JE, Hwang GS, Yoo DY. Effects of Cordyceps militaris(CM) on osteoclastogenesis and gene expression. The journal of oriental obstetrics & gynecology. 2012; 25:3. 16–26.


34. Yim CY. Nitric oxide and cancer. Korean journal of internal medicine. 2010; 78:430–6.


35. Han M, Wen JK, Zheng B, Zhang DQ. Acetylbritannilatone suppresses NO and PGE2 synthesis in RA W 264.7 macrophages through the inhibition of iNOS and COX-2 gene expression. Life Science. 2004; 75:675–84.
crossref

36. Seo WG, Pae HO, Oh GS, Kim NY, Kwon TO, Shin MK, et al. The aqueous extract of Rhodiola sachalinensis root enhances gene in RAW264.7 macrophage. J Ethnophamacol. 2001; 76:119–23.
crossref

37. Horwood HJ, Page TH, McDaid JP, Palmer CD, Campbell J, Mahon T, et al. Bruton’s tyrosine kinase is required for TLR2 and TLR4-induced TNF, but not IL-6 production. L Immunol. 2006; 176:6. 3635–41.
crossref

38. Turini ME, DuBois RN. Cyclooxygenase-2: a therapeutic target. Annu Rev Med. 2002; 53:35–57.
crossref

39. Yang M, Birnbaum MJ, MacKay CA, Mason-Savas A, Thompson B, Odgren PR. Osteoclast stimulatory transmembrane protein (OC-STAMP), a novel protein induced by RANKL that promotes osteoclast differentiation. J Cell Physiol. 2008; 215:2. 497–505.
crossref

40. Kim MH, Chun YN, Yim MJ. Effect of pentoxifylline, a phosphodiesterase, on osteoclast formation. Yakhak Hoeji. 2004; 48:3. 197–201.


Editorial office contact information
3F, #26-27 Gayang-dong, Gangseo-gu Seoul, 157-200 Seoul, Korea
The Society of Korean Medicine
Tel : +82-2-2658-3627   Fax : +82-2-2658-3631   E-mail : skom1953.journal@gmail.com
About |  Browse Articles |  Current Issue |  For Authors and Reviewers
Developed in M2PI