Home | Register | Login | Inquiries | Alerts | Sitemap |  


Advanced Search
JKM > Volume 39(2); 2018 > Article
Park and Lim: The Experimental Study of the Beneficial Effect of Zingiberis Rhizoma on Post-menopausal Obesity Using Ovariectomized Rats

Abstract

Objectives

This study was performed to investigate anti-obesity effects of Zingiberis Rhizoma on ovariectomized rats in order to determine the possibility of the clinical use in preventing and treating post-menopausal obesity.

Methods

To investigate how menopause affects obesity in woman, rats were treated with Zingiberis Rhizoma extracts. We measured various biomarkers including GOT,GPT, leptin, ghrelin, adiponectin, PPAR-γ mRNA, total cholesterol, triglyceride, HDL-cholesterol, liver weight, estradiol, uterine weight, and calcitonin, which are linked with obesity and menopause.

Results

There was a significant decrease in group which was given Zingiberis Rhizoma extracts 100 mg/kg and lipid level found in blood(total cholesterol, triglyceride). Fat accumulation of liver cells was repressed, liver function was improved and leptin and adipomectin levels were significantly normalized. In addition, expression of PPAR-γ was significantly increased.

Conclusions

The results indicated that Zingiberis Rhizoma extracts have anti-obesity effects on ovariectomized rats through improving liver function and lipid metabolic function.

Fig. 1
Weight changes of ovariectomized rats by different concentrations of Zingiberis Rhizoma extract(25, 50, 100 mg/kg)
jkm-39-2-106f1.gif
Fig. 2
Effects of Zingiberis Rhizoma extract(100 mg/kg) to depress fat accumulation of liver tissue of ovariectomized rats (n=8). # p < 0.05, compared with the sham control. * p < 0.05, compared with the OVX control. Magnification = 40X.
jkm-39-2-106f2.gif
Fig. 3
Effects of Zingiberis Rhizoma extract(100 mg/kg) to change PPAR-γ mRNA expression of muscle tissue of overiectomized rats. #p<0.05,compared with the sham control.*p<0.05,compared with the OVX control.
jkm-39-2-106f3.gif
Table 1
Experimental Design of Animals
Group(n) Treatment
Sham(6) Sham-operated rats
OVX(8) Ovariectomized rats
OVX+Red clover(8) Ovariectomized rats supplemented with red clover extracts 3.3 mg/kg bw/day
OVX+G-25mg/kg(8) Ovariectomized rats supplemented with Zingiberis rhizoma extracts 25mg/kg bw/day
OVX+G-50mg/kg(8) Ovariectomized rats supplemented with Zingiberis rhizoma extracts 50mg/kg bw/day
OVX+G-100mg/kg(8) Ovariectomized rats supplemented with Zingiberis rhizoma extracts 100mg/kg bw/day
Table 2
Primers
Target gene Sense (5′-3′) Antisense (5′-3′)
PPAR-γ TCGGAGGGCTCTGTCATC CATCTGTACTGGTGGGGACA
Table 3
Effects of Zingiberis Rhizoma on Body Weight gain and Feed Efficiency Ratio of Ovariectomized Rats for 8 Weeks
Group1) Initial body weight (g) Final body weight (g) Body weight gain (g/week) Food intake (g/week) Fer2)
Sham 163.2±2.98 281.5±12.3* 118.3±12.2* 8.2±0.49* 0.13±0.02*
OVX 163.0±7.18 362.3±10.33# 199.2±11.78# 9.6±0.71# 0.18±0.01#
OVX + Red Clover 163.5±5.63 362.7±23.78# 199.2±19.46# 9.2±0.60 0.19±0.02#
OVX + G-25mg/kg 163.4±6.16 367.0±18.88# 203.5±15.39# 8.9±0.55 0.20±0.01#
OVX + G-50mg/kg 163.3±6.92 360.3±20.19# 197.0±13.89# 8.9±0.54 0.20±0.02#
OVX + G-100mg/kg 164.2±5.76 339.8±18.9#,* 175.6±16.15# 9.3±0.65 0.17±0.02

1) refer to comment in table I.

2) Values are mean±SD.

3) #p<0.05,compared with the sham control.

* p<0.05,compared with the OVX control.

Table 4
Effects of Zingiberis Rhizoma Extract(100 mg/kg) on Liver Function of Ovariectomized Rats
Group1) GOT (Karmen/mL) GPT (Karmen/mL)
Sham 51.4±11.3* 27.5±5.8
OVX 96.7±24.1# 36.7±4.6
OVX +Red Clover 61.7±8.0 29.7±3.3
OVX + G-100 mg/kg 56.1±8.5* 29.5±4.9

1) refer to comment in table I.

2) Values are mean±SD.

3) #p<0.05,compared with the sham control.

* p<0.05,compared with the OVX control.

Table 5
Effects of Zingiberis Rhizoma Extract(100 mg/kg) on Lipid Levels and Liver Weight of Ovariectomized Rats
Group1) Total Cholesterol(mg/dL) Triglyceride (mg/dL) HDL- Cholesterol (mg/dL) Liver Weight (g)
Sham 78.8±8.7* 58.5±16.3* 39.9±5.0 9.7±0.7*
OVX 107.7±3.4# 93.7±11.2# 43.9±3.4 11.7±0.6#
OVX + Red Clover 71.6±8.3* 71.7±7.5* 42.4±5.0 11.2±1.3
OVX + G-100mg/kg 67.2±8.9* 70.7±10.8* 45.2±6.4 10.5±1.0

1) refer to comment in table I.

2) Values are mean±SD.

3) #p<0.05,compared with the sham control.

* p<0.05,compared with the OVX control.

Table 6
Effects of Zingiberis Rhizoma Extract(100 mg/kg) on Lipid Levels and Liver Weight of Ovariectomized Rats
Group1) Leptin(pg/mL) Ghrelin(ng/mL) Adiponectin(ng/mL)
Sham 6.1±1.1* 57.4±0.7* 6.80±0.57
OVX 13.0±1.9# 59.2±0.3# 5.68±0.66
OVX +Red Clover 9.1±1.7 59.2±0.7 6.83±0.67
OVX + G-100 mg/kg 8.7±1.8* 58.5±0.7 7.12±0.37*

1) refer to comment in table I.

2) Values are mean±SD.

3) #p<0.05,compared with the sham control.

* p<0.05,compared with the OVX control.

Table 7
Effects of Zingiberis Rhizoma Extract(100 mg/kg) on Female Hormone of Ovariectomized Rats
Group1) Estradiol (pg/mL) Uterine weight (g)
Sham 52.1±9.2* 0.740±0.043*
OVX 29.7±7.5# 0.076±0.003#
OVX + Red Clover 51.9±8.9* 0.084±0.003#
OVX + G-100 mg/kg 31.5±4.2# 0.083±0.003#

1) refer to comment in table I.

2) Values are mean±SD.

3) #p<0.05,compared with the sham control.

* p<0.05,compared with the OVX control.

Table 8
Effects of Zingiberis Rhizoma Extract(100 mg/kg) on Hormone Related to Osteoporosis of Ovariectomized Rats
Group1) Calcitonin (pg/mL)
Sham 76.1±1.3
OVX 72.5±2.6
OVX + Red Clover 77.4±2.0
OVX + G-100 mg/kg 75.8±1.5

1) refer to comment in table I.

2) Values are mean±SD.

3) #p<0.05,compared with the sham control.

* p<0.05,compared with the OVX control.

참고문헌

1 The society of korean medicine obstetrics and gynecology. Oreiental obstetrcis & gynecology. Seoul: Euiseongdang publishing company;2016. p. 228–9.


2 Choi YD. Clinical gynecology. Seoul: Koera medical book publishing company;2001. p. 305–26.


3 Carr MC. The emergence of the metabolic syndrome with menopause. J CLin Endocrinol Metab. 2003; 88:2404–11.
crossref pmid

4 Ozebey N, Sencer E, Molvalilar S. Body fat distribution and cardiobascular disease risk factors in pre and post menopausal obese women with similar BMI. Endocr J. 2002; 49:4. 503–9.
crossref pmid

5 Ahn DK, Park KM, Park KW, Kang H, Kim SJ, Jang BH, et al. Effects of Herbal Mixture Extracts Containing Angelica gigas Nakai and Cuscuta chinensis Lam. on Menopausal Symptoms in Ovariectomized Rats. J Korean Soc Food Sci Nutr. 2016; 45:8. 1083–89.
crossref

6 Winneker RC, Harris HA. Progress and prospects in treating postmenopausal vaginal atrophy. Clin Pharmacol Ter. 2011; 89:129–32.
crossref pmid

7 Samat A, Rahim A, Barnett A. Pharmacotherapy for obesity in meonopausal women. Menopause Int. 2008; 14:2. 57–62.
crossref pmid

8 Jeonguk hanuigwadahak bonchohak gongdong gyojaepyeonchanwiwonhoe. Herbology. Seoul: Younglimsa publishing company;2016. p. 375–7.


9 Kang KH, Lee BC, Ahn SY, Doo HK, Ahn YM. The Effects of Zingiberis rhizoma on Hypothyroidism Rat induced by PTU. Korean J Orient Int Med. 2006; 27:3. 677–87.


10 Nam SC, Kang H, Shim BS, Kim SH, Choi SH, Ahn KS. Angiogenic inhibitory effect of Zingiberis Rhizoma. J Korean Orient Oncology. 2006; 11:1. 55–63.


11 Shin JH, Lee SJ, Sung NJ. Effects of Zingiber mioga, Zingiber mioga Root and Zingiber dfficinale on the Lipid Concentration in Hyperlipidemic Rats. J Korean Soc Food Sci Nutr. 2002; 31:4. 679–84.
crossref

12 Mckinlay S, Jefferrys M. The menopausal syndrome. Brit J prev soc Med. 1974; 24:108–115.
crossref pmid pmc

13 Poehlman ET. Menopause, energy expenditure, and body composition. Acta Obstet Gynecol Scand. 2002; 81:7. 603–11.
crossref pmid

14 Meli R, Pacilio M, Raso GM, Esposito E, Coppola A, Nasti A, et al. Estrogen and raloxifene modulate leptin and its receptor in hypothalamus and adipose tissue from ovariectomized rats. Endocrinology. 2004; 145:3115–21.
crossref pmid

15 Wang JF, Guo YX, Niu JZ, Liu J, Wang LQ, Li PH. Effects of Radix Puerariae flavones on liver lipid metabolism in ovariectomized rats. World J Gastroenterol. 2004; 10:1967–70.
crossref pmid pmc

16 Hong SM, Chil WH, Kim JM, Yong MJ, Lee CB, Park YS, et al. Correlation of Serum Total Testosterone with Obesity and Metabolic Syndrome in Premenopausal and Postmenopausal Women. Korean J Obes. 2004; 13:4. 300–7.


17 You YO. Side Effects and Management of Postmenopausal Hormone Replacement Threapy. J Menopausal Med. 2004; 10:1. 14–20.


18 Kim DI. After July 2002, What can we do for menopausal women-A review of recent research about HRT and a proposal of alternative therapies for treating climacteric or menopausal syndrome-. J Orient Obstetrics & Gynecology. 2004; 17:3. 105–15.


19 Lee SC, Chung SI, Kang MY. Water extracts of Eucommia ulmoides improve lipid, glucose, and antioxidant metabolism in ovariectomized rats. Korean J Food Sci Technol. 2016; 48:6. 604–9.
crossref

20 Sung HM, Shin YR, Chae HJ, Seo HY, Wee JH, Jung KO, et al. Pomegranate Extract Improves Menopausal Syndrome in Ovariectomized Rats. J Korean Soc Food Sci Nutr. 2015; 44:4. 506–15.
crossref

21 Lee SH, Kim DC. Aqueous Extracts of Jibaekjihwang-tang Ameliorate Ovariectomy -induced Climacterium Symptoms in Mouse. J Korean Obstet Gynecol. 2017; 30:2. 16–36.
crossref

22 Kim HC. Korea medicine pharmacology. Seoul: Jipmoondang publishing company;2001. p. 250–252.


23 Wronski TJ, Cintron M, Dann LM. Temporal relationship between bone loss and increased bone turnover in ovariectomized rats. Calcif Tissue Int. 1988; 43:179–83.
crossref pmid

24 Abe T, Chow JWM, Lean JM, Chambers TJ. Estrogen does not restore bone list after ovariectomy in the rat. J Bone Miner Res. 1993; 8:831–8.
crossref pmid

25 Zhang Y, Proneca R, Maffei M, Leopold L, Friedman JM. Positional cloning of the mouse obese gene and its human homologue. Nature. 1994; 372:425–32.
crossref pmid

26 Yoshimatsu H, Itateyama E, Kondou S, Tajima D, Himeno K, Hidaka S, Kurokawa M, et al. Hypothalamic neuronal histamine as a target of leptin in feeding behavior. Diabetes. 1999; 48:2286–91.
crossref pmid

27 Maffei M, Halaas J, Ravussin E, Pratley RE, Lee GH, Zhang Y, et al. Leptin levels in human and rodent: measurement of plasma leptin and ob RNA in obese and weight-reduced subjects. Nature Medicine. 1995; 1:1155–61.
crossref pmid

28 Perusse L, Collier G, Gagnon J, Leon AS, Rao DC, Skinner JS, et al. Acute and chronic effects of exercise on leptin levels in humans. Journal of Applied Physiology. 1997; 83:5–10.
crossref pmid

29 Hu E, Liang P, Spiegelman BM. AdipoQ is a novel adipose-specific gene dysregulated in obesity. J Biol Chem. 1996; 271:10679–703.
crossref pmid

30 Rudman D. Effects of human growth hormone in men over 60 years old. N Engl J Med. 1990; 323:1–6.
crossref pmid

31 Fatouros IG, Tournis S, Leontsini D, Jamurtas AZ, Sxina M, Thomakos P, et al. Leptin and adiponectin responses in overweight inactive elderly following resistance training and detraining are intensity related. Clin Endocrinol Metab. 2005; 90:11. 5970–77.
crossref pmid

32 Kojima M, Hosoda H, Date Y, Nakazato M, Matsuo H, Kangawa K. Ghrelin is a growth-hormone-releasing acylated peptide from stomach. Nature. 1999; 402:656–60.
crossref pmid

33 Asakawa A, Inui A, Kaga T, Yuzuriha H, Nagata T, Ueno N, et al. Ghrelin is an appetite-stimulatory signal from stomach with structural resemblance to motilin. Gastroenterology. 2001; 120:337–45.
crossref pmid

34 Hansen TK, Dall R, Hosoda H, Kojima M, Kangawa K, Christiansen JS, et al. Weight loss increases circulating levels of ghrelin in human obesity. Clin Endocrinol. 2002; 56:203–6.
crossref pmid

35 Kliewer SA, Forman BM, Blumberg B, Ong ES, Borgmeyer U, Mangelsdorf DJ, et al. Differential expression and activation of a family of murine peroxisome proliferator-activated receptors. Proc Natl Acad Sci. 1994; 91:7355–9.
crossref pmid pmc

36 Rosen ED, Walkey CJ, Puigserver P, Spiegelman BM. Transcriptional regulation of adipogenesis. Genes Dev. 2000; 14:1293–307.
pmid

37 Handschin C, Spiegelman BM. The role of exercise and PGC1α in inflammation and chronic disease. Nature. 2008; 454:463–69.
crossref pmid pmc

Editorial office contact information
3F, #26-27 Gayang-dong, Gangseo-gu Seoul, 157-200 Seoul, Korea
The Society of Korean Medicine
Tel : +82-2-2658-3614   Fax : +82-2-2658-3631   E-mail : skom1953@daum.net
About |  Browse Articles |  Current Issue |  For Authors and Reviewers
powerd by m2community